Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13607B11
Clone ID IST13607B11
Vector VICTR74
Project tigm

Sequence tag IST13607B11HMR1
Sequence
AGGCAACTCTCGAATCTTTTACCGAGAGGTGCTGCCAATCCAGCAGGCACGCAGGTGAAGGTTTACTCAAGGGCTTAATG
GAGGGACCTCAGTCCACCACCTGGGGCTCAGAGCCTGGGAGGGCAATGAAAGACACCTGGGAAGAAGGGGTGCTGGCTGC
CCAGGTATGCCCATACCACATGTCTCCCCATGTGTCTCCAGGGCAGAAGTCGTGTTTCTCCATGGAAAAGCATTTAATTC
CCACACATGGGAACAGCTGGGGACGTTGCAGCTACTGTCAGANAGGGGCTACCGGGCTGT
Sequence Type genomic DNA
Unitrap ID UNI16644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106346175..106346474 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042210 (Abhd14a) NM_145919 abhydrolase domain containing 14A Gene [Source:MGI Symbol;Acc:MGI:1915894]


Sequence tag IST13607B11BBF1
Sequence
GCCTCTGGTGAGACCAGTCAGGACTGTGACATTAGGGCCTCTCCAGAGTCGCGAAGTCTGCTCGGGTGGGCCAGGCAAGC
CCATATACAGGAGGAACACGAGCAGCAAGCCTAGACCCAGCAGGGCTGCCTGGTACCGGCTCATGAATTTCTTCTGTACC
ATANAACCTGGAGGAGAAAGGGGAAGAGATAGGCTGAGGAANACTTTCCTTCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106346471..106346683 207
 
EST/CDNA Est Name
  AI587684.1 - CB952955.1 - BY079153.1 - BE859581.1 - BY078964.1

 
Come back to gene AI587684.1 - CB952955.1 - BY079153.1 - BE859581.1 - BY078964.1


For any suggestions or comments, please send an email to unitrap@crg.es