Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14812A6
Clone ID IST14812A6
Vector VICTR76
Project tigm

Sequence tag IST14812A6BBF1
Sequence
CAGCTAGAGACACAAGCTCTGGGGGTACTGGTTAGTTCATTTTGTTGTTCCACCTATAGGGTTGCAGACCCCCTTCAGCT
CCTTGGGTACTTTCTCTGGCTCCTCCATTGGGGCCCCTATGTTCCATCCTATAGATGACTGTGAGCAGCATCCACTTCTG
TATTTGCTAGGCACTGGCATAGCCTCACTGAAGCTATATCAGGGTCCTTTCCGCAAAATCTTTCTGGCATATGCAATAGT
GTCTGGGTTTGGTAACTGATTATGGGATGGATCACTGGGTGGGGTANTCTCTGGATANTCCATCCTTTTGTCTTANCTCC
NAACTTTGTCTCTAACTCCTTCNNTGGGTGTTTTGTTACCTATCCCANGGATGAATGAANTATTCNCACGTTGGTCNTGN
Sequence Type genomic DNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114466993..114467391 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST14812A6HMF1
Sequence
CANCNNNANACACAAGCTCTGGGGGTACTGGTTAGTTCATTTTGTTGTTCCACCTATAGGGTTGCAGACCCCCTTCAGCT
CCTTGGGTACTTTCTCTGGCTCCTCCATTGGGGCCCCTATGTTCCATCCTATANATGACTGTGAGCAGCATCCACTTCTG
TATTTGCTAGGCACTGGCATANCCTCACTGAANCTNNATCANGGTCCTTTCNNCNNAANCNTTCTGGCNNATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es