Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0098
Clone ID GC0098
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0098
Sequence
TATTTTTCAGAGCACTGGCAAATTCTGGGCCACCTTTGTCCCC
Sequence Type mRNA
Unitrap ID UNI138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84323161..84323201 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018697 (Aatf) NM_019816 apoptosis antagonizing transcription factor Gene [Source:MGI (curated);Acc:Aatf-001]

 
Come back to gene ENSMUSG00000018697


For any suggestions or comments, please send an email to unitrap@crg.es