Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14848F10
Clone ID IST14848F10
Vector VICTR76
Project tigm

Sequence tag IST14848F10HMR1
Sequence
AACACACATACACACACACACACACACACACACACACC
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 17581308..17581345 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30918036..30918073 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14848F10HMF1
Sequence
TGTTGTGTGTGTGTTGTGTGTGTGAATGAATCAGACTTTCAGAACGGATCTACACAATTCAAAAGGCCCACATCGCCAGT
GGACGTAAGTCAAAGACAAACTGAATGAGACTCAGGTTATCTTGTTGCCATTGGAAAGATCAAACCTTTACTTCAAAATT
CTACCGAGAAAACCCGGGGAATCTCCCCAGATAAATCCAAATGAGCCAAGTGTGGGCCCTACCATGCATGAGTTTGCTTA
AAGAACTTTTTTTTTNANTAAATATTTTTACTTAAGGTGNGNGGTGTTGCCNGNNTGNGGCCNGTGNNCNANGTNCNTTN
ANCANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es