Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12871D1
Clone ID IST12871D1
Vector VICTR76
Project tigm

Sequence tag IST12871D1HMF2
Sequence
TTTCTTTCTTTCTTCCTTCCTTCCTTCCCCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTNTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTN
Sequence Type genomic DNA
Unitrap ID UNI30967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 62898010..62898104 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21281883..21281977 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 24450888..24450982 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37591945..37592039 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61184807..61184901 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5657402..5657496 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 63918495..63918589 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060843 (Ctnna3) NM_177612 catenin (cadherin associated protein), alpha 3 Gene [Source:MGI (curated);Acc:Ctnna3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10264212..10264306 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6271707..6271801 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18339702..18339796 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 124218129..124218223 89
NO GENE  


Sequence tag IST12871D1BBF1
Sequence
CACCAGACGCTGTCTCTATGCCCTTGGACTTCCCAGCCTCCCGAAACCACGAACTCCAAACCCTCTGTTGTTTATAAGCT
ACTCAGTTTCNNGTGCTTTCTTACAGCAACGGCAAAAATGGACTAANACGGCCTCCAGGTTCTCTTTTGTAATTTGGGAA
GAGTGGAGCCAACCTTACTGCTGACTTGAGAGAGTTAAGTGAAATTGTATGAGCCGAGTGTCANCGAGGAAAGTGACTCA
CGGGGNACACTGAGCTGATATAGCCAGAGGTTACTATACTTGCAGGGCTGAAGGGCGTGGCCCAGTGGTGGAGTGCTTGC
CTGGCATACACAGAGCCCTGANTTCAATCCCCAGCACTTAAAATACCATGCTTGCTTCAGTGTTCTTGCCTTACTCCGAN
TCTGCCCTTCACAAAATGAACGANTTCTCGATGCCNAGCATCTGATGATNNNGTCACTCTGCCCANTGTGCNCCNCGGCC
CCATACTCTNCNGGCNNCCAGTGANATTNANTNATNNCTANCNTCNCNTGANNNCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060843


For any suggestions or comments, please send an email to unitrap@crg.es