Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566D2
Clone ID IST14566D2
Vector VICTR74
Project tigm

Sequence tag IST14566D2HMR1
Sequence
ATACATAGTCNCCTTGTAGAGCCNGGTGGGGACTCAGTCCTATTTAACAGAAGGAACTTCCAAAGTGCCTGTTACAGTAG
CATTTCTCTGTAAAAGTTTTGTGTGGGAAGTAAATTACACTCTCGGTAATGGTTTGTTAGCAGTGTAAGC
Sequence Type genomic DNA
Unitrap ID UNI14917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94825268..94825416 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074897 (CT030190.9) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3USJ7]


Sequence tag IST14566D2HMF1
Sequence
GTATCTCTCTGCCTTTGTCTTACAGCTGTCTCCTTTATTCTGAGTCATCTAATCAGCTGTGCATGTAGACACATTAATAA
TAACTCAGAGTCAGAGCTGGGGATGCCTCACCTATCTCATTCCTTCAAAGGGGGAGGAAGAGGCAAGAGCAACTGAGGAA
TATAGGGAATGCTTCCGATTGTGTTATCCTGGATCCCAAGAAAAGTGCAGCATCCCAACCCTCCATCCCCAGGAGAGCGA
ACTCACCCCTGAGGATGGACAACCTTCTATAGCAGATGAGGTAATTATCAAGTGAGTCACTCTTCCACCAAGACCACTTA
AATATGCACACCTCCTACCTACTGCCCCAGCCCCCCCTCTATTCAAATCTAAAGCTCTTTGTAGTGGGCCAAAGACAAAC
TTTGGATTACTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94824857..94825271 415
NO GENE  


Sequence tag IST14566D2BBF1
Sequence
GTATCTCTCTGCCTTTGTCTTACAGCTGTCTCCTTTATTCTGAGTCATCTAATCAGCTGTGCATGTAGACACATTAATAA
TAACTCAGAGTCAGAGCTGGGGATGCCTCACCTATCTCATTCCTTCAAAGGGGGAGGAAGAGGCAAGAGCAACTGAGGAA
TATAGGGAATGCTTCCGATTGTGTTATCCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94825077..94825271 195
NO GENE  

 
Come back to gene ENSMUSG00000074897


For any suggestions or comments, please send an email to unitrap@crg.es