Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15063F5
Clone ID IST15063F5
Vector VICTR80
Project tigm

Sequence tag IST15063F5HMF2
Sequence
ATAAGTTATTGGTTATGATTAAAAATTTGTAACATTGGTAACAAAAAGTTA
Sequence Type genomic DNA
Unitrap ID UNI2143 UNI30968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166451: 3911..3960 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12619435..12619484 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9594127..9594176 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 40317091..40317140 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18013250..18013299 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22633266..22633315 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62657241..62657290 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41033954..41034003 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5064472..5064521 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105621453..105621502 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 78981290..78981339 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27793292..27793341 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18353248..18353297 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 66564837..66564886 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039005 (Tlr4) NM_021297 toll-like receptor 4 Gene [Source:MGI (curated);Acc:Tlr4-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21608018..21608067 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 62188006..62188055 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150531199..150531248 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 92523411..92523460 50
NO GENE  


Sequence tag IST15063F5BBF1
Sequence
ATAAGTTATTGGTTATGATTAAAAATTTGTAACATTGGTAACAAAAAGTTGACTTAAAACTGGTAACTCTGGGTTAGAGT
AATTTAGAACTACAACATGCAACATGAGACAACCCATGGGAACAGGTCTCTAAAGATACGCCTGAATTGGGTAATATTCT
GTGTAATTCTTATCCTAGAAATCTGATTTATAAAAGATAAGATTTAGGGTAGTGTCTTTGAGATATATTGGCGGCTACAC
CTTCTTGTGTTTGTGTGCAGGAACAGACAGCCAAACTTTGTAGCAAGTAATGTTTTTAGAGTTCATTTTTAAAGAAAATA
GATTGTTTACNCTGTTAAAATTGAGTTTTGCTTCTCAAAATTGTGGTTGTGCTCTNNNNNNNCAAGAGAAATTGNNGGCT
TCTCNNNNNNTGGAGCANCNNGCTAAATCGGCTCCTCTAAANTCTATAAAGCCTCCTGAGTGGCCNANTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039005


For any suggestions or comments, please send an email to unitrap@crg.es