Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0071
Clone ID DB0071
Vector pGT1lxr
Project sanger

Sequence tag DB0071
Sequence
AGGGCCTCTACTGAGTGATGTGAGGGGACCTAGCAAGCTCAGAACTCCAGACATGGATTTAGTCACCTATGATGACGTGC
ATGTCAACTTCACTCAGGAAGAATGGGCTTTGCTGGATCCTTCTCAGAAGAGTCTCTACAAGGGTGTGATGCTAGAGACC
TATAGGAATCTCACAGCTATAGGTTACATTTGGGAAGAACATACAATTGAAGACCATTTCCAAACTTCTAGAAGTCATGG
AAG
Sequence Type mRNA
Unitrap ID UNI1338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176864970..176869341 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es