Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D014G07
Clone ID D014G07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D014G07
Sequence
AATCTGCCATTTTCTCTACCTGAGTGAGTCTCTGCTGTCCGGAATTCTCTGGTTTTCTTCGCAGGCAGTGTTCTGCCCAC
TGGCCCACCACCTCAGGGGAACGATGGCCACAGAGTCTACAGCCGCTGCTGCCATCNNNGCGGAGCTGGTTTCCGCTGAC
AA
Sequence Type mRNA
Unitrap ID UNI1110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116299937..116300098 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SD014G07
Sequence
TTCATGTATTCATTTGTGTTCAGTTACACTTTGGCTGTTGGTGAAGTAATTACCAGCTTCCTTCCTGAATGGGTATTTAC
AGAAAATTACATGCCTACTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116297752..116297855 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es