Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13244F3
Clone ID IST13244F3
Vector VICTR74
Project tigm

Sequence tag IST13244F3HMR1
Sequence
NNCCNNANAGAAAGNACNTGTAAAAATGTCATTAACCTGTACCTGCCNNTNNNNAATGAGTGGGTAAACTGAGTCTGTTC
TTTCCAAGGTTCCCAGCTAATTAAAAAAACCTGCTTAGCCCAGGGTATGCCAGTAATTTCAGCACTTGAGACCCTGTCTC
AAAAACACAAAACAATAACAACCAAAAAGATCTACTGACATTCACGTGGTTTGACAACAGTACACTTGACTGGGTGAGGC
GCTCCTGCCGAGCCTGAGATGGAAGATTCTGCATTTGTAGCCTGCATAAGGTGCATAGGGTGATTCTGTCTCAGATATGG
GCAAGACCCCGTATGTCTGTACATGACATCAGGAGAAAGTATAAAAAGGAAAACTATGACAATAGCATTTTTCACTCTTA
AAATATCTTACAGGCTGGGGCTTGGTAGTGCACACTCCTGCTCTCAGGANGCAGAGGCAAGCAGATATCTGTGAGTTCAA
GCCCAGCTTGGTCTATATGTTTCAGANAANGANGTAAAGATAGAGAGAGAGAGTANAGTGAGAGGGGN
Sequence Type genomic DNA
Unitrap ID UNI21857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124702466..124703004 513
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004263 (Atn1) NP_031907 atrophin 1 Gene [Source:MGI (curated);Acc:Atn1-001]


Sequence tag IST13244F3HMF1
Sequence
NGGTGATTACTCTTTGTCCATCACCCCTGGGCCATACTGAGGCAGGCAATGAGGAACCAGTGAGTCTAACCTTTCCAGGA
AACTTAACTACTTATTCCTAAGGGGGCACAAAATGGATGGGACAGAGCCCCAAGTCCAAACTTTCAACTGATGCTTTGCC
CTGCAAACTAGTGTACTTCAACTATAGCTACAATTACACTTTCTAGATAGTTTGTGGATTGGTTTTNAACAGAGTATGCA
TTACCNNNNNNNNNNNNNNNNCCNGAAATCCNNCACTTGANAGGTGAAGGCAGGACCANCCACTCTCGGCNAATANCNNG
TTCAAANCNNNTCNNAGTTTCANGAAATCCTCTCAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124703018..124703373 242
NO GENE  

 
Come back to gene ENSMUSG00000004263


For any suggestions or comments, please send an email to unitrap@crg.es