Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12326C1
Clone ID IST12326C1
Vector VICTR76
Project tigm

Sequence tag IST12326C1BBF1
Sequence
ACTGGAAAGTCTATGAACTCTTAAAGGCAAACTATTACAATTTAAGCAAAGGATACCATAAAGTCACACCATATGACAGA
TCTG
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28084465..28084547 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST12326C1HMF1
Sequence
ACTGGAAAGTCTATGAACTCTTAAAGGCAAACTATTACAATTTAAGCAAAGGATACCATAAAGTCACACCATATGACAGA
TCTCACATGGGAGGTTTAATGGGGAGGGAGTCTACAGAGGCTGCCTCTGGGCAAGGGCGGAGGGTAGAAGGATCAGGGAG
AGGAGGGACTGGCCTTTTATAAGGGGATGTAGCACAAGCACAGGGGTTATGCATCTCATAGTGACAGTGGGAATGTGTCA
CATCTTGGCAGCTAGTGATGACGTCTGCTGTCCCTGGATCCCTGGGGGCANATGGTGGAGATGCCTGGTTGCTAACACAT
GCCTGGTTGCTAACACAAACAGTATTTGTCATANGTGCTTCATAAACNAGTCTGGGATGAGTGAGTGAGTGAATGAGTGA
NTGANTGAGTGAATGAGTCTCAGGCGGGGTTGCNNGNANNGGTGTGTCNNAGCCNCTTTANTCTATTTTACACNCATGCA
TTTTCTANTGTNNACNNNAATCNNANTGTCNNGGGTGTGANGCCNNNNTCCTGGGTCTTTCNTGGTAAACCTTGGNNATC
CNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es