Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14914D9
Clone ID IST14914D9
Vector VICTR76
Project tigm

Sequence tag IST14914D9HMR1
Sequence
CTGGGATATGGACTGTAAATTAGAGGTCACTGGATAAAGGTTTACTCTGAAGTGCTCTAGATATCCAGCCTGTGGAGGGA
AGGGCAGACTCAGGATGGAGCTAAAGGAGAAGCTGAGCTGAAATTCAGGCTTTGAAGAAAGTANCAGGGAGACTTTGTTC
ACCGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI30985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135574827..135574995 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]


Sequence tag IST14914D9HMF1
Sequence
GAGTCCCACNNNNGTTACNNANCTTGTCNAGGTGCNCNNNCCNNGANTGGTGTTGTGAGAGCTAAAGCCCANTATCTTCA
AACCGCCATTCACAGTCCCTTGATGACACGTCCATCACTTTGACCAAAAAATAAACAAACAGCTGGATGTTGTCCTCAAA
GCANACTTCANNAANCAAATTANCACAGAGAAAAACATTGTNNAAATNANAAGACNACTTCCAGGCTACCANTGCANCTC
AAGGGTGGCTTGCTTGTCCNGNATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es