Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13303D9
Clone ID IST13303D9
Vector VICTR74
Project tigm

Sequence tag IST13303D9HMR1
Sequence
GTGTAGAAAATTAGCTCTTTGAGAACCCCTTCAAACTGAAACTTTTTTTGTGTAATAACCAGAGTATTTTGTATTTCTTT
AAGACATAATAGCTACAAGACAGGGTGGACAGGAGCACCAACAGCTTTGGAATCTGGGAGATACGTACTGTCTTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651471..66651628 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST13303D9HMF1
Sequence
ACACTTAAGAAATTCTTACCAGGAGTTAAGTGGATTCATTAGGATGTATATTTTAAACATATCTCATTTCTATTCAATTA
ATATTCCTGAGCAAATAACATTTTCCTTATTTGAAAAAAAATTGAAAAATTACAGTATGTATCTCTAGAACCATCCCCAA
AACAAACAAAATCTGTCTCTTCCATTTATTTTTAACATTTATGATAATTGAACCTAGTTAGAATAACTTTCTACTGNGTC
CCAGCCTAACCTTTTAAGTACTANATGTTCAAAATACTTTGTGTGAGAAATTAACTTTCAAAATAGAAAATTCCCACACT
ANCTGTACATCTATCATTGCCTGCTACNNNNATTTTCNATTTCTTGGGCCTANATTCCTAATATTTCATATAATTCTATC
ANTTTTTATAANANAATGTACTCGCTTAAGAGTTCATGTNATCTGATTANATGAAATATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651013..66651474 434
 
EST/CDNA Est Name
  BB627678.1

 
Come back to gene BB627678.1


For any suggestions or comments, please send an email to unitrap@crg.es