Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14992D12
Clone ID IST14992D12
Vector VICTR78
Project tigm

Sequence tag IST14992D12HMR1
Sequence
TTGTTTTCTGTTTTTAACTTTTGTGTCCTTCACAGGTATTTCACCCTTAATTCTGGGCTTTCTGGGCTTGATCTTGTTGC
TCTGGCTCTAGTTCAGTCTTTCAGCCTTTGTGCTGTTGGTCTTTGGGGCNNGAAAAGATTTTATGAAGGACTTCCTTCTC
CATCACAGGTTGCTTGGTAGTGCCCCTGGCCTGTATTCACTGANAGGCCAGTAATCGTCCCCCTCACCACTATCTCCCAC
TTCCACTGANAATCACTTTTCTACTTCACTCGCTTTCAACTGCTGTGTCATGCTCCCACGTGACATTATAACAGACCTGT
GTTTTCTTTCCCCATGGACGGACACGGACATTTANGTTGTTTCTGGAATGTCAGTTCTTANGAAGACTCTTTCAGTGANG
CTTTTTTCCATTCTCATACCCCACCCCCTTTTNATTCTTTCTGACAGGANCTCACTTAATAGTCCTAATTGTCCNNAAAC
TCACTATGTGNATGACACTGNNCAAACTNNNAACNGTCNNANCTTTCNNNGNNNTT
Sequence Type genomic DNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103260194..103260720 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]


Sequence tag IST14992D12BBF1
Sequence
AACATTTTCTATTGTGTTTATGTGCATGCATACTTAAGAAGACACGGAGGTTGGAAAGGGCAAAGGAATAGAACAATAGG
AGAGCAAAAGGGCAATTCATCTACTGAGGTGCTCAACTTCGGCTGCAGAGTGAACACACACAAGTATGCTATAGACTCTC
TCCTCTTCCTACAGGCCTCTCATTTTAACTTTTTNAGTCNAGGTCTTGCTATGTATACCAGAATGGCCCTGAATTCNCTA
TGTAGCACAGGTTCAGGTTGGCCTTGAGCCTCCCAAGTGCTGNNNNNNGGAGCATGAANNNCTCCCAACTGGGTTNNTTT
CCNNTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es