Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10987C2
Clone ID IST10987C2
Vector VICTR76
Project tigm

Sequence tag IST10987C2HMR1
Sequence
AACCNAAACCTCTGGTATGTTGTCCTGGGCATGGAAGCTGTAAAAGCAATCTGGGCATGACAAGCAGGTTCAAAATGCCT
TCTCTTATTTCNTACN
Sequence Type genomic DNA
Unitrap ID UNI30999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11871759..11871853 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]


Sequence tag IST10987C2BBF1
Sequence
GTTAGAAGTCTCTTCAAGTATAATACAGAGTTAGCAATATATCCATCACCCAGGGGACTGTTTTATAATAGAGTCTGATA
CAGAATAAGCAGCTCCATTTCACTTGTTCTTCANAAAAACAACACANACAAGCAACTGGTCTACCAGCCAAGGAAGCATG
TTTAAGGAATGAANTTACTTGCTCCCCCCACCCCCCAAAACCTTAANCAGTANAAAGCATCTTGGATTTGATAATANATT
TANATGCTTGTTTGACCTGGGCTATGANCAACAAATGGGCTCAAGGATCTTTCTAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11871851..11872150 284
 
EST/CDNA Est Name
  BY122902.1 - CJ163851.1 - BY126942.1 - CJ167458.1 - CJ163422.1 - BY298955.1 - BY304463.1 - BY007254.1 - BB859190.1 - BY773037.1 - BY772552.1 - BY133060.1 - BY133740.1 - BB650664.1 - BY772264.1 - BY072321.1 - BY777478.1 - CJ171457.1 - BY067110.1 - BY133761

 
Come back to gene BY122902.1 - CJ163851.1 - BY126942.1 - CJ167458.1 - CJ163422.1 - BY298955.1 - BY304463.1 - BY007254.1 - BB859190.1 - BY773037.1 - BY772552.1 - BY133060.1 - BY133740.1 - BB650664.1 - BY772264.1 - BY072321.1 - BY777478.1 - CJ171457.1 - BY067110.1 - BY133761


For any suggestions or comments, please send an email to unitrap@crg.es