Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P126F08
Clone ID P126F08
Vector ROSAbetageo+2
Project ggtc

Sequence tag P126F08
Sequence
AATTCAAATCTGAATNNNNGGCGGCGGCGGCGGCGGCAGCGGATTTGGCGGCGGCTTTGGCTCTGAGGGACAGGGGTAGT
GTTCCTGGTTTTGGTGGGGTTTGCCTTTAGTTTAATTTTCCTTTTCTAGCTTCCCTTTGCCGGCTGGTGCGTACGTTGTA
GTCCCCCGAGGCCATGTCAGGAGGCCGCAGCCCGGAGCAG
Sequence Type mRNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104430679..104430859 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]


SPLK-Sequence tag 5SP126F08
Sequence
TCTATGACACCATGTCTCTGTTTTGCATATCCTAGGAAACAGGAGTTTTCCTTTGTTCCATAGTGTGACACATAAGCCAC
ACTATGCCTGTGCTTAATGTTACAAGAAGTTAGTTGTAAGTAGCTAACTATTCC
Sequence Type genomic DNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104444056..104444189 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]


SPLK-Sequence tag 3SP126F08
Sequence
GCTGGGNNCTGAACACCAGTCCTCATGAATGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es