Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11413A6
Clone ID IST11413A6
Vector VICTR76
Project tigm

Sequence tag IST11413A6HMF1
Sequence
CTGTGTGCTANATATTAACAGAACTTCTGCTTTACTTCTGAACTTTTAACACTGAGCACAGATCTAATTTTTTTTGTTTT
TTTGCAGTTATACAGGAGGGCAGGAAGTAAGGTGAAAATGGATTTTTGGCCCTTGTAGTTTTCTAGCCACTTCTGTGTAT
TTTATTTTAAAAAATATTTTTTAAAAAGTGTTTTGAATTAAGGAATCAACCCGCATGTCNNACTTGTGAAAAACTATGGA
ACCACACACCATCATCAANAAGGGAACATTTGCTATCNNGAATGTGGTCCCTCANTCNCCTAATAAAAGGGCGGGCGCTT
ANCTACACATGGGGGCAAAGAAACAGAACTCTTCACTTGATAGAGTGAGAGCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84284107..84284483 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]


Sequence tag IST11413A6BBF1
Sequence
CTGTGTGCTANATATTAACNGAACTTCTGCTTTACTTCTGAACTTTTAACACTGAGCACAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84284419..84284483 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es