Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14012B1
Clone ID IST14012B1
Vector VICTR74
Project tigm

Sequence tag IST14012B1HMR1
Sequence
TTTTAGTTTCCTCTTCTTGATCCTGAAGGCTTTCCTCTCCTCATTTTTGGCAATTCTGTTTTCCNGTTGATGCANTCNNC
AATTTTTGGGGTTTNGNTACTTAAGTGATTGATATGGTTAATACATTAGGTTTGGCTTTTTAAACCTTTCTGATATATTA
TTGTCTGTGTGTCCTAGTTAGCN
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121810883..121811064 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]


Sequence tag IST14012B1HMF1
Sequence
AAACTGTTTCCCNCNNGNANAAACNNANNANNNNNNNAGTNNATTTNNNNAANACANNNNNANNNNNNGGTCNACTATTT
TCCNNANAANCNGTNNAATTANATTATNNTGAATAACATCNCACANNGTANATAGCACCACAAATAAAGAGAAAGCCNAA
GACANATANACGTATAAATCTTTTTAAAATGAAGTACAAGACTATAATAAAAAAAAATTAANAAATTACNGGTCAATACT
CATCCNGTGTATTCNGTTTCTCCTCTTTGCCAATAAAACAAAATANATTAAAAATGGCAAAAACCTGGTCAATTGGACAT
AAAGGCTGTCTAAGGAATGGGAAGCATTTTTTACCCNNATTCACATATTATAGTGGCCTAATATACNAAATATATAACNA
CCTCAAGAANCTAGACTATCCAAANCANAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14012B1BBF1
Sequence
AAACTGTTTCCCAACTATCAAAAACTCAAGAAACTCATAGTAAATTTTCAGAAGACAAAAATAGGTAAAGGTCTACTATT
TTCCANAGAAACAATATAATTAGATTATAGTGAATAACATCACACAATGTANATAGCACCACAAATAAAGAGAAAGCAAA
AGACAGATAGACGTATAAATCTTTTTAAAATGAAGTACAAGACTATAATAAAAAAAAATTAANAAATTACNGGTCAATAC
TCATCNNGNNNNTTCTGTTTCTCCTCTTTGCCAATAAAACAAAATANATTAAAAATGGCAAAAACCTGGTCAATTGGACA
TAAAGGCTGTCTAAGGAATGGGAANCATTTTTTACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811062..121811418 333
NO GENE  

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es