Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0091
Clone ID GC0091
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0091
Sequence
AATGACAGCAGCACAGAGCGCATGAGGCAGCAGTGGCAGCCCATTGTCATAGGCCTCCTTGAGTGTGTACACCGGTCGNG
GCCTTGGANGTGCATCCAGTAGCAGCCGTGAG
Sequence Type mRNA
Unitrap ID UNI135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6318466..6318573 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024769 (Cdc42bpg) CDC42 binding protein kinase gamma (DMPK-like) Gene [Source:MGI (curated);Acc:Cdc42bpg-001]

 
Come back to gene ENSMUSG00000024769


For any suggestions or comments, please send an email to unitrap@crg.es