Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0059
Clone ID DA0059
Vector pGT1lxr
Project sanger

Sequence tag DA0059
Sequence
CCAAGCGCTTTCTGCGAGCTTTCCGAACTGCGCTCTGAAGTTTCCAGAGGGAGAAGCCCGGCCGGCCGGCAGGGACAATG
GAAGAAAGCGAAGGCCAGAAATGTGAGCCGAACCTGCCTCCCTCCGGAGACAGCAGACAGATGCCCCAACAAGGGAGAAG
CAATCTTCATGTAACATCTCAGGAAGATGCAGCATGCCGCAGGCCCAGGGAACGCCTTTCTAATGGAAACGCCAGGGCTC
AGGTTTCCAAGCCTGCCCGAAATATCCCAAGGAGACACACTCTAGGTGGGCCCCGAAGTTCCAAAGAGATCCTGGGAATG
CAGCCATCTGAGATGGACAGGAAGAGAGAGGCGTTCCTAGAACATCTAAAGCAGAAGTACCCCCACCATGCCACAGCCAT
CATGGGCCACCAGGAGAGGCTGAGGGACCAG
Sequence Type mRNA
Unitrap ID UNI588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20441408..20451869 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es