Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P105A11
Clone ID P105A11
Vector ROSAbetageo0
Project ggtc

Sequence tag P105A11
Sequence
GTAACGAGCGGCGGCGGCGGCGGGTCCCGAGTCCAACGAGAGCAGCAGC
Sequence Type mRNA
Unitrap ID UNI4705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41222074..41222122 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]


SPLK-Sequence tag 5SP105A11
Sequence
AATTCAGAGAACAGGCTGGTGGGATTGTCAGTGGCGTACTCCCCTCCATGATAAAAACGCACTAACAG
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41201977..41202044 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]


SPLK-Sequence tag 3SP105A11
Sequence
GCGTTCANTTCCCAGANNTCTCTGTAACACGGAAAAGAGCCTGATTTCTCAGAAGTTTTTCTTCCGACCTTCCACATAAT
TGACTCGTGACATAATGTGTTGGGTGTGAACACACAAAAAATTCATAAGTAAAATAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es