Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10556A7
Clone ID IST10556A7
Vector VICTR76
Project tigm

Sequence tag IST10556A7BBF1
Sequence
NCNTGAGCCCTGCCTGGCNAANGGGCTTTTGTCTCTGTCCCTTTATCTACTTGTATN
Sequence Type genomic DNA
Unitrap ID UNI30846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103695436..103695488 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]


Sequence tag IST10556A7HMF2
Sequence
GAGTTGGGTTCAAGTGTAATAGTGTAAGGGAGGGTGAGCATGGGTAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI29705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39613155..39613206 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022304 (Dpys) NM_022722 dihydropyrimidinase Gene [Source:MGI Symbol;Acc:MGI:1928679]

 
Come back to gene ENSMUSG00000022304


For any suggestions or comments, please send an email to unitrap@crg.es