Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13218D8
Clone ID IST13218D8
Vector VICTR74
Project tigm

Sequence tag IST13218D8BBF1
Sequence
AACCCCTTGCTGTTGAGTGTGTTTGCAAATATTTTCTTCCCGTCTGTCACTGATGTTGTCTTTTTTCCNTATAAAAAAAA
TTTTTTTTAAAAGCTTTGN
Sequence Type genomic DNA
Unitrap ID UNI28336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6411636..6411733 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]

 
Come back to gene ENSMUSG00000032946


For any suggestions or comments, please send an email to unitrap@crg.es