Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10978A8
Clone ID IST10978A8
Vector VICTR76
Project tigm

Sequence tag IST10978A8HMR1
Sequence
NTACAGATAGATAGATGGATGGATGGATAGATTGATAGATAGGATGGCTGATGTTCAGCTTGCTTCTCTTTATTCAACCC
AGGATTCTGTCTACATACCAGCCTTTCTACCTCAGTAAACCTAATCTAGAAGCCCTCACTGGTATGCTCAGAGATGTGTC
CTAGGTGAATTGAGATCCCCTCAGTTGAGCCCATTGACCTCTCTGC
Sequence Type genomic DNA
Unitrap ID UNI14987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45596546..45596749 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST10978A8HMF1
Sequence
TATCTACCTAACTACTTATCTATCCATCCATCCATCCATCCATCTATCTATATATCTACCTATATATCTACCTACCTATC
TACCTAACTATCTGTAGCTTTCTTTCTGTCTCCTCTATGTGTGTCTGTCAATCTGTCTCTGTGACTCCAACGTATCTGTC
TCTGTCCCTCTGTCTGTCCCTCTATCTGTCTCTCTGTGTGTCTCTGTTTCTCCCTATCTCTCTCTGCCTATCTCTGTCTC
TCTGTCTGTCTCTCTCTGTGTTTCTCTGTCCTTCTGTCTGTCTGTGTGTGTGTCTCTGTCTATCTCTCTCTGTCTCTTTG
TCTCTCTCTCCCTCTCCATTTCCTGAATGTGGACACACAGTGTGAGTTGTCTCTATGTCTTCCCGTCTGCTGTGTGGTCT
TTTGAGTCAAAACAAACCCTTAACTATTTNAAGTTGTTTCTTCACAGGTGTGAAAAGTAAGTAGTAATTAGTCCTATGCN
CACCGTATGANGGANCAAGCTANCCAAGCACAGTGTNNAACAGTTNGCTTTAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45596750..45597281 516
 
EST/CDNA Est Name
  BI100822.1 - BY719067.1 - BY732779.1 - CB272518.1 - CB273205.1

 
Come back to gene BI100822.1 - BY719067.1 - BY732779.1 - CB272518.1 - CB273205.1


For any suggestions or comments, please send an email to unitrap@crg.es