Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046E4
Clone ID IST10046E4
Vector VICTR75
Project tigm

Sequence tag IST10046E4HMR1
Sequence
NAATAACGTCATANNANNNGAGGGTTTAAGGTATGTGCACACTGATACTGTTCCCATTAAGATCTGGCACTTTAGTTGGG
TATGATAACTTANACCAGAAATCCTAGCACTTGGGGAGCCTGGAGCAGTAGGTTCTTGCATTTAAGGCCAGCCTGGGCTA
CCTAATTAGTTACACCCATCTGCCAAACTCCCAAGAAAAACGCCAGACAAAAGAATTGGAGCCTAGTTCTCTTGCCCCTT
GAGTATGGACTGGACTTAGGGGAGCAATTATAATGTGCAAAATAATTGAAGCACAAGTCAGAGTGTGTCGTGACTGGGTC
GCTGAAAGGCACTTTGGTTTTCTGTTCTCTCATGCANGCTGANCTTTCTGTGACATGTTTGCTGGTTTAN
Sequence Type genomic DNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7724326..7724713 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]


Sequence tag IST10046E4BBR1
Sequence
AGAATAACGTCATATTACGTGAGGGTTTAAGGTATGTGCACACTGATACTGTTCCCATTAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7724324..7724388 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]


Sequence tag IST10046E4HMF1
Sequence
ATTCTCAACTCTACATTAAATGCAATTTCAAAAATCATCCAATTTTTGTTTGCTTATTTGAATACGGGGTCTCACCATAG
GCTAGCTAAAGTTAGCCTGGAACTTGTTAAAGCTCCAATTCACAACCCTGCCTCAGTTTTCTGATAGATGGTGATGAGGC
ATCTGGTTCAATGGCACAGTAAAAGCAGACACAGCTCTCTCTCTTTGTTGGGATATAAGCCAAGGGACTTGCACATACTA
GGAAGGCACTCTGCCACTGAGCTGAACCCTATAGAAGGACTGAGGACCTTAAACTAAAAGCAAAAGTATACAGCTAACGT
AATAAGCTGCAGAAGAGTATCTTTGGGACCTGGGCAGGGAGGATTTCTTTAAAAGTACAGACACGCTGGTTGTGGTGATG
ATCCCAGCACTGAAGAGGCTGAGGCAAAAGTTTTATGAGTTCCAGGGTGACCTGAGCATACAGTGAGGGACAGACCACAG
GGTGAGAAATATTAGAACAACAAAAAGTATTCAACTAAAGATAACTACTTACAAATTTAATAAAAAATCCATGAAAATCA
CCTGAGAAATGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7723758..7724328 565
 
EST/CDNA Est Name
  AI481304.1


Sequence tag IST10046E4BBF1
Sequence
ATTCTCAACTCTACATTAAATGCAATTTCAAAAATCATCCAATTTTTGTTTGCTTATTTGAATACGGGGTCTCACCATAG
GCTAGCTAAAGTTAGCCTGGAACTTGTTAAAGCTCCAATTCACAACCCTGCCTCAGTTTTCTGATAGATGGTGATGAGGC
ATCTGGTTCAATGGCACAGTAAAAGCAGACACAGCTCTCTCTCTTTGTTGGGATATAAGCCAAGGGACTTGCACATACTA
GGAAGGCACTCTGCCACTGAGCTGAACCCTATAGAAGGACTGAGGACCTTAAACTAAAAGCAAAAGTATACAGCTAACGT
AATAAGCTGCAGAAGAGTATCTTTGGGACCTGGGCAGGGAGGATTCTTAAAAGTACAGACACGCTGGTTGTGTGATGATC
CCAGCACTGAGAGGCTGAGCAAAGTTTATGAGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7723889..7724328 412
 
EST/CDNA Est Name
  AI481304.1

 
Come back to gene AI481304.1


For any suggestions or comments, please send an email to unitrap@crg.es