Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12179E2
Clone ID IST12179E2
Vector VICTR76
Project tigm

Sequence tag IST12179E2BBF1
Sequence
TTTGTACTAACACTGTTTTTGTCTTTATCCAGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTT
TGAAATTGAGCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292718 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST12179E2HMR1
Sequence
NNGTTGGATGAAGATCTGGTGAGACTGTGGCCNGCTTACCTCCCGGTGGTGGGTCGGTGNNNACACAGTGATTTTGTTTG
TTTGTTTGTTTGTTTGCTTGTTTACTTGCTTGCTGAAATCTTGTCCTTCCATCACACCCACACCCTCTCCCTCCCCTCTT
CCTTCCTCTTCTTCCTTTTTATTCTTTCCTTTCCTTCCCTATGTCCCCCCCCCACCCTCTTTCCTTTCTTTCACGAGGTG
TCTCATCTGTCCCAGGCTGTTCTAAAACTTATATGTANCAAAGGATGGNCTTGACCTTCTTCTCTTCCTATCTCCACTTT
CTGTTTGTGGGCATATGCTATACTACCNNNTTTAAN
Sequence Type genomic DNA
Unitrap ID UNI30546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133714948..133715240 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037443 (Ccdc21) NM_144527 coiled-coil domain containing 21 Gene [Source:MGI (curated);Acc:Ccdc21-001]

 
Come back to gene ENSMUSG00000037443


For any suggestions or comments, please send an email to unitrap@crg.es