Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135B10
Clone ID P135B10
Vector ROSAbetageo0
Project ggtc

Sequence tag P135B10
Sequence
CCAAGCGGCAGATTCGAAACCGGTTCCAGCTCACCCTGGACAAGACCATAGAGAGNNGCAAAGACCAGCTAGGCATAAAT
GAGATCTCAGAGGATGTTTATACNNNCGTGGAGCACAGCGATTCCGAGGACTCCGAAAAGTCGGAGAGCAGCGACAGCGA
GTACGTCAGCGATGAGGAACAGAAGCCCAAGAATGAGCCCGAGGACCCCGAGGACAAAGAGGGGAGTCGGGTGGACAAAG
AGGCCCCTGCCATCAAAAGGAAGCCCAAACCCACAAACCAGGTAGAGGTCAAAGAGGAAGCGAAGAGCAACTCTCCTGTC
AGCGAGAAGCCGGACCCCACACCCGCCAAGGACAAGGCCAGCCCAGAGCCTGAGAAGGACTTTGTAGAGAAAGCAAAGCC
ATCACCTCATCCCACAAAGGACAAACTGAAAGGAAAGGATGAAACGGATTCTCCCACAGTGCACTTGGGCTGGGATTCGG
TCTCGCAGAGTGACTTTCTCATAGTTATGCTGACGCTGCCTCTTCTCCGAGAATTGTGTCAANAGATCCAACGAAAACGT
CTCCGAGNNCAGNNCGTCGGTAACCCAGNNGTG
Sequence Type mRNA
Unitrap ID UNI113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165637927..165640888 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


SPLK-Sequence tag 5SP135B10
Sequence
AATTCCTTCAGGCAGTCTGCCTCTGCTGGGTTTGACCTAGAACTTGGCCTGCCATGTGAAGTCCCAGCTCAGGAAGCCAA
TCCAGTTTCTGCTT
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165633453..165633546 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es