Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15045F4
Clone ID IST15045F4
Vector VICTR78
Project tigm

Sequence tag IST15045F4HMR1
Sequence
NNNNNTNCNTNNNNNNNNNNNNNNGCNNAATTACNTTCNTCTGANAAGGACAAAATTAAATTTTATCCCCTCTACTTTTG
ACATTGGAAGTAAAACTAATTTTCTAGAGCTTATTTAAATTAAGAGTGTACAAAGTATCCCTGACTGGTTGTTACAGACT
GAAGATTATTGTATTGTTATTANANTTGGTN
Sequence Type genomic DNA
Unitrap ID UNI581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8000469..8000630 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053110 (Yap1) NM_009534 yes-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:103262]


Sequence tag IST15045F4BBF1
Sequence
GGCGGACTTGAAGATCCCAGCAGCCCAAAAGGTAGTAGTAGTATGGAGGAGGCGGGAAGTGAAACTAAACCGGGTTGATG
CCGCTCCATGCCACAGGATGACAGCAGAATTCACCGATTCGACTTTTATTCAGAAGTAAGGTAAAGATCAGTGTTGGAAA
AATGTTCCCCAAGAAGGTCCTTGCCTCTCGATTTCCACTCGGCGCCGGGAAAGGTTATCAAGCAAGGCTAAGGACAGAGA
CGGGGGCAGTGTTTCTGTANGACTCANAGGTCCCAAAATTCAGCGGTTACACANTCGCCGGNNANGCANCCTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180445401..180445712 298
 
EST/CDNA Est Name
  BI109915.1

 
Come back to gene BI109915.1


For any suggestions or comments, please send an email to unitrap@crg.es