Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14374H8
Clone ID IST14374H8
Vector VICTR74
Project tigm

Sequence tag IST14374H8HMR1
Sequence
AATGTATATGATTACTCTGTCACTATCTTTAGACACCCTGGAAGAGGGCATCCCATTATGGATGGTTGTGAGACACTATG
TGTTTGACTGGGAATTGAACTCACAACCTCTTAATCACTCATCTATCTCTCCAGCCTTTTTTTTTTNCCNNAA
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21157423..21157571 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST14374H8BBF1
Sequence
CATTTAAAACAACAAAAGTACAAAACATACCGTAAATATCTTTATGCTTAGCATTAAAATAAGAAAAGTATTTACAAGTG
ATATATCTCACTACCTGTAACTTCCTTTTACGTGATTAAGCAAAGAATTCACATAAAACAAATCTGACAAAATATAAAAA
CAAGGTAAAATATATTGAGTATTGAACATTCTTTTGTTTTTCCATATGATTTTCAAAGTAAAAGTTTAAGGAAAGGAAAT
TACATATTTGTAAAATACTAGTACAAAATGTAAGTATGCAGAAAAAAACTACTCAATTTGTAAACACTACTTAATGTACC
TCAAGATGACATTACTGCATAACTTCAAATATGGAAAAAACTTATCAAACAGTTTCAGTTCACGTTGGGGTGGGGGATTG
GTTCTAATGCTNNGATTTANNCNNACCAAACCCTGAAGGCCCTTGTCCNCNNNTGGCTTNTGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21156964..21157426 438
 
EST/CDNA Est Name
  AA990349.1 - AA028210.1 - AA021806.1


Sequence tag IST14374H8HMF1
Sequence
CATTTAAAACAACAAAAGTACAAAACATACCGTAAATATCTTTATGCTTAGCATTAAAATAAGAAAAGTATTTACAAGTG
ATATATCTCACTACCTGTAACTTCCTTTTACGTGATTAAGCAAAGAATTCACATAAAACAAATCTGACAAAATATAAAAA
CAAGGTAAAATATATTGAGTATTGAACATTCTTTTGTTTTTCCATATGATTTTCAAAGTAAAAGTTTAAGGAAAGGAAAT
TACATATTTGTAAAATACTAGTACAAAATGTAAGTATGCAGAAAAAAACTACTCAATTTGTAAACACTACTTAATGTACC
TCAAGATGACATTACTGCATAACTTCAAATATGGAAAAAACTTATCANACAGTTTCNGTTCACGTTGGGGTGGGGATTGG
TTCTNATGCTNNGATTTAATCGNACNNNACCCTGAANGCCCTTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21156982..21157426 423
 
EST/CDNA Est Name
  AA990349.1 - AA028210.1 - AA021806.1

 
Come back to gene AA990349.1 - AA028210.1 - AA021806.1


For any suggestions or comments, please send an email to unitrap@crg.es