Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14726B8
Clone ID IST14726B8
Vector VICTR76
Project tigm

Sequence tag IST14726B8HMR1
Sequence
GGTGTATGGGCATGAGCCCCTCTGGTCAGCTCCATGCCGAGAAGCTGGGGCTGGGTAGGCCCTCTCCTCAGGATAGGGAT
TCCTGTTGGGCCCATGGTCAGTCTC
Sequence Type genomic DNA
Unitrap ID UNI31026

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134027303..134027407 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059981 (Taok2) TAO kinase 2 Gene [Source:MGI (curated);Acc:Taok2-001]


Sequence tag IST14726B8BBF1
Sequence
ATGGTAGCCCATAACCATCTGTAATTCATACAATTCCCTTTTCTGGTGTGTATAAAGGCAGCTACACTGTACTCATATAC
AAAAAATGAATAAATATCTTTTTTAAAAAAGATGCACTGGGAAGTTTATTACTGCAAGTCAGCAAAAATTTGTAAGGGGG
GAAAAAATCCTGATAAGACCTAACTACTTAGTCNGTAATATAGAGGGGGTAACATTCAAACATTGGGTGTGGACACTTCT
TCATTGTGCGTCTAATATCTGAAATCCGCTGATTAAAACTGTTTTGTTGTTGGCTTANAGACACNTCCNACTGTGGGACA
GACAGTCTANACNAAGGNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 35025784..35026120 325
 
EST/CDNA Est Name
  DT920010.1 - DT922430.1 - AA794005.1 - AI552885.1 - D76744.1 - AA980848.1 - BQ956883.1 - CJ084417.1 - AA461984.1

 
Come back to gene DT920010.1 - DT922430.1 - AA794005.1 - AI552885.1 - D76744.1 - AA980848.1 - BQ956883.1 - CJ084417.1 - AA461984.1


For any suggestions or comments, please send an email to unitrap@crg.es