Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12077C1
Clone ID IST12077C1
Vector VICTR76
Project tigm

Sequence tag IST12077C1HMF1
Sequence
CCATTTTCAGGATGCTTTTGAGCTGGGCCAGGTTTTTCTGGGAAGCAATGAGCAGGGATATGAAGTATGGGAAGATCTGC
CCAAGGGCATCCGAGGGAACCGCTGGAAGGCTGGACTTACCGTCATCACTCCGGAGCGGAAATTCATCTTCACCTGCCCC
ACTGAAAAGGAACAGCGAGAATGGCTAGAGAGTCTGCGGGGCGTCTTGTCCAGTCCCTTGTCACCCCTCCACCTCCTCAG
TGAGAAGTGGGGGATGGGTGGGGGTTCTTTTGGGTGANGGCANANAANGGCTCCTTCNCTACAGTCCCANAGGGGCCTGA
CTCAGCTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI31031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79990538..79990877 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST12077C1BBF1
Sequence
CCATTTTCAGGATGCTTTTGAGCTGGGCCAGGTTTTTCTGGGAAGCAATGAGCAGGGATATGAAGTATGGGAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI21030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79990538..79990616 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es