Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14490A8
Clone ID IST14490A8
Vector VICTR74
Project tigm

Sequence tag IST14490A8HMR1
Sequence
NGNNNNNNTTTAGTACAGTTCCTCATATTGTGGTGACATCTCCCCAACCATAAAAATTATTTTCGTGGCTACTTTATAAC
TAATTTTGCTACTGTTAGTTAGTTATTAGTTAAATATCTGATATGCAGGATATCTGATATGTGACCCCCAACAGGGGTCT
CAATGGATAGGTTGCTCTGTGGGTTTGCTTATTTTAGGTGTCTTACATAGAGTTGAGCAGTATATGTTTTTCTGGATTTG
GCTTGCTTTGCAAGCAGAAAGCCTTGGAGGTTCAACTTTGTGTGTGTTTTTGTGGCTATGTGCCGTGCTTCACATGTTGG
CN
Sequence Type genomic DNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6101730..6102042 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]


Sequence tag IST14490A8HMF2
Sequence
CCAGCATTAGATGGTTGAGAATCNCTGCCNTAGAGAAAATACAATGGCTCCTAGGGCTAGGGCAGGTGGAAATTTTCTAA
AATCTCTTGAGACNAATACAAAATGCAGTGAACATGGTAAAAGCCATCAAATTGTTCTAAAAGGTGAATTTATATTATGG
AAGGGATCCCCCTAATTCAGTAAAACTGCCATAGGCAAGAAACACTATCATGCCTAAACAAGCCCCATCACACACCCCAC
TAGCNNCAAAACCAAAATTCACACCCGANCTCAAAAGACCCCAGTGTGGCTTTGGTTTTACATACTCCCATCTTCCAGAC
ACCCCAATATCACTATCTACCCCTGCTCCCCTCTGAANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6102048..6102404 345
 
EST/CDNA Est Name
  BE333928.1 - BX522846.1 - AA798321.1 - BY059641.1 - BY105429.1 - BY311923.1 - BY064813.1 - BF662190.1 - BY064589.1 - BY069174.1 - BY339406.1 - BY339665.1 - BY300835.1 - BY340465.1 - BY337260.1 - BY068921.1 - BY106111.1 - BY108661.1 - W36520.1 - BY708653.1


Sequence tag IST14490A8BBF1
Sequence
CCNNCATTANANGGTTNANAATCNCTGCCATANNNNAAANACAANGGCTCCNNNGCTAGGGCNNTGGAANTTTTCNAANA
TCNCTTGANACNAATACNAAATGCAGTGAACATGGTNAAAGCCATCNANTTGTTCTNAAAGGTGAATTTANATTATGGNA
AGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BE333928.1 - BX522846.1 - AA798321.1 - BY059641.1 - BY105429.1 - BY311923.1 - BY064813.1 - BF662190.1 - BY064589.1 - BY069174.1 - BY339406.1 - BY339665.1 - BY300835.1 - BY340465.1 - BY337260.1 - BY068921.1 - BY106111.1 - BY108661.1 - W36520.1 - BY708653.1


For any suggestions or comments, please send an email to unitrap@crg.es