Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10032A11
Clone ID IST10032A11
Vector VICTR75
Project tigm

Sequence tag IST10032A11BBF1
Sequence
AGTTCAAATCCCAACAACCACATGGTGACTCACAACCATCCATAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI22725 UNI24228 UNI31037

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3595533..3595586 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67783587..67783640 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71118461..71118514 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16972894..16972947 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 77716257..77716310 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74451197..74451250 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60050123..60050176 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69420305..69420358 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96530551..96530604 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 147189396..147189449 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123396515..123396568 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126318343..126318396 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 118340026..118340079 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033308 (Dpyd) NM_170778 dihydropyrimidine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2139667]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131184602..131184655 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 115250638..115250691 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16727902..16727955 52
NO GENE  

 
Come back to gene ENSMUSG00000033308


For any suggestions or comments, please send an email to unitrap@crg.es