Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P137H12
Clone ID P137H12
Vector ROSAbetageo0
Project ggtc

Sequence tag P137H12
Sequence
GNNCNNNCGGCGTGACGGCGATGGCGGATATCGACAAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAG
Sequence Type mRNA
Unitrap ID UNI134 UNI10872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 126883629..126883696 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044341 (AC164158.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608557..122608624 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]


SPLK-Sequence tag 5SP137H12
Sequence
CGCTTTGGATCTGGGGCGCGCATACAAGCCCCTCCGGGTTTGGGGACCCCATTATTTTTTATCACTCCCCT
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608710..122608780 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]


SPLK-Sequence tag 3SP137H12
Sequence
ATCTGGAGTCCAGGACTCATCAGAGGGACTTGGCTTGGCAGGACGACGTCCCAGTGCGATGAGAGTCCGTCTTCTGCATT
TTCCTACCCCCTCCACCCTCCCCTCAAAGCCATCCATCCTCCAGCGTTCTTTCCCCCTTGAACGTGCATCCGCACACGGA
CCCAGTCCGGGTGACAGTGTGGCTCTCTCTGATCATCAGATTGTTGTGTCCCTGAGGACAGGGGGACGCTGCCGCGTTCA
GCGAGCACCCGCCAGGTAGGTGCTGTGTTGTTATTATCCTGGAAGTGGGTTTCGCAAGAGAAACTCCCAAGACCTCGCTG
GACCAAGAATTAACAGTTAAAAGTCAGGTTTCAAACCCCGGGGTAGCTAGGAACCTAGAGAGAACCTGCCGCCTTCCAAC
TGTTCACCCTGTGGGAACCCAGGATGTCCAGTGGTTGAGGAGAGGTTCAAAAACAAAAACCCAGCTTTCCTTTTGTCCGA
CTTGGGGGTTTCTGCCGTGTGGTTTCCTACTTTGGAGATTTCA
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608802..122609325 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es