Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11524G1
Clone ID IST11524G1
Vector VICTR76
Project tigm

Sequence tag IST11524G1HMR1
Sequence
TNNCNTTCNNTTCATGGCTTCACCGCTTGTAAATAAATGCCAGAGCCGAGGTTTGGACAAAGGTGGCCTGGCTCCAGAGA
GTGAGGGCATGTGTCATGGTTTGTATCCATGTTACAGTGGGTTGGGCAGTGGGTAGTTCCCCAGGTAGGTGGATAATGGT
TC
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73021105..73021260 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]


Sequence tag IST11524G1BBF1
Sequence
CCTCATAGGCTGTCTAANAGATAANTGAATCGGTACAAGGAAAACCAGGTANAAAATCATCTGTGGCATAGCCAGAACCA
GACAGGTGTCTTGACTCTCATTGATTGTCACATTTGTCATCGCCGGGATGTATCCCATGANAAAGTCTNNTGCNTGTACC
CNNAGAGGAATGAATAANAAGGATNNNGGTANGATGGANGTAANGCAAACAAACNCCCATAGGCAAACAGTGCANCAAGA
TATATGTCACANCTATACANATNACATAAAGCTACTTATNCTACCNAGAAAGCGGGCCGCTTTCTATGGACCNNNNNNGA
CAGACTTCCAGGGTGGTTAAGAAAGCTAGGTGTNAAAAAATGTTGAGCTGGGGGGCTGGANNNATGGCTCANCAGGTAAN
AGCACTGACTGCTCTTCTGAANGTCTTGAGTTCANATCTCANCNACCNCATGGNANCTTACAACCNTNCCNTAATGAGAT
CTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es