Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P138D02
Clone ID P138D02
Vector ROSAbetageo0
Project ggtc

Sequence tag P138D02
Sequence
TCNNNGCTCGGGGGCTGCGGGCTGGGATAATTAATCGGAGTCAGCAGTGGTGCGGTGGAAATATCGGTTTTTGTTCTGGA
GAAATANNG
Sequence Type mRNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70350750..70350810 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


SPLK-Sequence tag 5SP138D02
Sequence
AATTTGTAATCTCCCTGTCTGCTTCCTGAGTGCTAGAATTAAGTTTGTGCCACCAAGTTTGTGCCACCATACCTAGTTTA
GCTTGTTTTGTTTGCCCTATGTTCCTTGAAAGACNNCGCGACGGAGCATCTCAAGCGNNNNNTTTTATGTAA
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70327815..70327926 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


SPLK-Sequence tag 3SP138D02
Sequence
CCTGTTTTTNNNNNNGGTTCCCTCTACTATCTGACAAACTGATATCAGGACGCAAAAGAACTAGAAAACAGCAAAATGTG
CTTATAAAATGGACAATGGACTTGACATCTCTTTGAAGACATACAACAGCCAGTAAGTAAAGGAGGGTATGCTCAATGGC
GTTGCACAGGGAAGGCCTTTAGGATAGCAATTCCCAAAATCCAGAGTAACAAATGCTGGCAAGAATGTGGAGAAAATAGA
ACATTTGTTCTCTGCAGGTTAGATTATAAAATGGCAGCTGTGGAAAATGTATGGTGTTTCCTCAAGTATCAACAATCTAG
CAATTTTAATTCTGGTAGAAATAGCCGGAGTGTCTACCAGATGACCAGATATATAACATGTCACACACAATGGAAGAGCA
GTGAGCCTCAATAGGGAAATCATGATATATGCTACAATATGGATGAACTGTAAAGACCCAGTGCTAGGTTAAATGAGCAC
AACACANCAGGATAAACAAGTGCTTCCATTTACAGGAAGGACTCTGACCAGNTA
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70327302..70327810 495
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es