Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10550A2
Clone ID IST10550A2
Vector VICTR76
Project tigm

Sequence tag IST10550A2BBF1
Sequence
NAGGGGAACAGAAAGTCAGGGAACGGAGAAAACGGGATGACTGTGCAGGTTTTAGAGTTCCTCTTTTAGGCGAAGAGAGT
GTTCTGTCAGAGAGCATGGTGAGACACCCATGTGCCAAAACTGCCATTGGATTGTGCACCTTAAGCATGAGTTATCTGGT
AAGTGAATCAAATTGCAAAGGCTTTTGTTTTGGGGAGAGTTTTAAGAAGCCCCCTGGCTACAGTTTAAAGAATGATGGAG
GAAGGCGGGAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI4925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71176117..71176371 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST10550A2HMF1
Sequence
TTGGGGAACAGAAAGTCAGGGAACGGAGAAAACGGGATGACTGTGCAGGTTTTANAGTTCCTCTTTTAGGCGAAGAGAGT
GTTCTGTCAGAGAGCATGGTGAGACACCCATGTGCCAAAACTGCCATTGGATTGTGCACCTTAAGCATGAGTTATCTGGT
AAGTGAATCAAATTGCAAAGGCTTTTGTTTTGGGGAGAGTTTTAAGAAGCCCCCTGGCTACAGTTTAAAGAATGATGGAG
GAAGGCGGGAAGGATCCAGAACATTGGTCAGGAGGCTGTTGCCNGTCATAGCTGTTAANAACGGGTGGGAACATGCTANG
AGATATATCTTTGANNGNNNTTTATGCTGGTGAACGTAAATATATGACTTTAAATTGGCTTTGTTTGGCTTTTTGAAACT
GCAGTCCANGGTGGCCTTGANCTCCTTTATAACTTTGAACTCCAACCCNTCTGCTTCTCTCTCCCTAGTTTNGANGTTAC
AGAANTGCTCCCCCACGCCCNNNNNNCTNTTTAANTTTNATCTTTTCTTTTGGGAACNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10550A2HMR1
Sequence
CCTTCTACTCTCCAGTCGGTGAAGGCCACTTCCCTTTAAGTCTCTAAACAGTTACCTGCCATGGACGAAACTTTCTGTAT
TCTCCTATCTGGCTGCAATCACACACACGCCTCCCCTACCATCTCCATGCCCATCCACACGCAGGTACCAACCGACACCC
ACTTCCTACTTCCTCAGTGCTCTGCTGAATGGCTGAACTGAACGGTCTCTCCAGCCCCANAAAATGTANTCACCATTAAA
CAAATGTTAGGAGCATAACAACAGATGGAGTTGCAAGATACCAGGACCAACCACTCATTCCTCANANGCNAGCANCTGGG
TGAGGTGTANCTAANCACATGGGAGACCGTGAACTCCATATCCAGCTCNNNNGANAGAGAGATGAANAGGGGGAGAGAGA
GAGAATCNGTATGTGGGGTGAACCGAATGAAACANAGGCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71176369..71176810 410
 
EST/CDNA Est Name
  BE912090.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770.1 - BY269876.1 - BY258620.1 - BY296846.1 - BY004613.1 - CJ170213.1 - BY013210.1 - BY011403.1 - BY133510.1 - BY775858

 
Come back to gene BE912090.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770.1 - BY269876.1 - BY258620.1 - BY296846.1 - BY004613.1 - CJ170213.1 - BY013210.1 - BY011403.1 - BY133510.1 - BY775858


For any suggestions or comments, please send an email to unitrap@crg.es