Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14577D2
Clone ID IST14577D2
Vector VICTR74
Project tigm

Sequence tag IST14577D2HMR1
Sequence
TAGGAGGTCTGGAGTGGAGTGGCTAGGGCTATAGGCTCAGGAATAGTCCAGTTTGGCGGGACCCTGGGTTCTGTTTAGTT
TCAGCCCTGCTGTGGCAGAGCCATACCTTAGGCTAGGTATGCACTTAGCTCTCCGATGCTACATTTCCTTTCTGCAAAAT
ATTGGCTTAGCGTGAATGCCTTGCTCANAAGT
Sequence Type genomic DNA
Unitrap ID UNI21030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79989833..79990023 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es