Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14791H12
Clone ID IST14791H12
Vector VICTR76
Project tigm

Sequence tag IST14791H12HMR1
Sequence
GCCTCTGCTGCTGTGCACAAGGGTAAAACACACTCTGCTTGCCCACCGACACTGAAAGAC
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4602630..4602689 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]


Sequence tag IST14791H12BBF1
Sequence
AGGCCTGCCCTAGGCGTCAATGGCTGGTGCTGCTGTTACTCAGGAGACCAGATAAGTATGGGCAACCAATCCATAAAAGC
AAGAAAACTGCACTTCCCAAGCCAAGCCGGGCCATTTCATGAACACATCAGGAGGCTCCACACATGTGACCCCCTCTCAC
CTCCTCGGGACAGACAACCCCCATCCACTGTGAACAACCACACCTGCCAACCCAACAGCAGGGGGTGAAGGCAGGCTCTG
GACTTTGGCCCTTCCCTCCCACTTCATTTATGCATTCCAGCACCAGCTGGGGTCCAGGATAAATCAGATGGAACAGGGCC
TGAANGTCGCTCAGTTACAGGCAACCCANGAAGCAGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4602276..4602633 354
NO GENE  


Sequence tag IST14791H12HMF1
Sequence
AGGCCTGCCCTAGGCGTCAATGGCTGGTGCTGCTGTTACTCAGGAGACCAGATAAGTATGGGCAACCAATCCATAAAAGC
AAGAAAACTGCACTTCCCAAGCCAAGCCGGGCCATTTCATGAACACATCAGGAGGCTCCACACATGTGACCCCCTCTCAC
CTCCTCGGGACAGACAACCCCCATCCACTGTGAACAACCACACCTGCCAACCCAACAGCAGGGGGTGAAGGCAGGCTCTG
GACTTTGGCCCTTCCCTCCCACTTCATTTATGCATTCCAGCACCAGCTGGGGTCCAGGATAAATCAGATGGAACAGGGCC
TGAAGGTCGCTCAGTTACAGGCAACCCAGGAAGCAGTGTCAGGGGCACACAGCTCTGCTAANGGTTGGGAGGGGCAGATC
TGATAAGGCNNTGGGGACACAAAGCAAACCTGGGAGCTGCCTACACTGCCNNGTACTTGGGANGCTGANNCANGGGGANT
ACAAATTCTGGNCTGTANANTGANTCCCCAANGCCNCTGTGGGTGACACAGTNANATCCTGTCTNNAAATGGANNNTNNN
AAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4602081..4602633 513
NO GENE  

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es