Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10066G9
Clone ID IST10066G9
Vector VICTR75
Project tigm

Sequence tag IST10066G9BBR1
Sequence
CGTTAACCCAACAATTGTTTAACAACCTGAACTACTTTTCATAACAACAAGATGCTCTTTTGTCTTTGTCCCAGAATTAG
TTCTCTTGGTTTTGGTGGATCCTT
Sequence Type genomic DNA
Unitrap ID UNI13419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62351599..62351701 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es