Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10900E7
Clone ID IST10900E7
Vector VICTR76
Project tigm

Sequence tag IST10900E7BBF1
Sequence
NNANNNNNTCTGACAAGAATTTTTATACATTTTTAAGGAGCTCCGAGCACCCCAGAATTAGATTATAAAATCATCCTCAT
AGTTCAGATTTATGTTCTTGTGAAAGTTTGGCAGCTCTGCTACCTTATGGTCGGTGTTTCCAAATTCTTGGCAGCTTATT
CAGTAAGAGCCCTTGGCTCACAGGGATTCNCAAAGGAAGCCACACAGCTTTATCGTTAGCGTGGGANACGCTCAAAACTG
ACAGTGGGCCANGTGGGCCCGANTACTCCAAGGGCTCANCGGTGGCTTGANGCTGCTCTTTTCGGGGTTCAAGANNAGAA
GGAGCTGGTTCCTGANGGGCCTGGTTTAAGTGGTTCTATGTTTGGTAGTTTGGTTTATACATTCATTCCTACTGTGCCTG
CCCCTTCCCTCCACTCAGTCTCCCTTTATTTGCNNNNNTGNATACACACCCNCAAACCAGTGCAGGCTANANTAAACCCT
TN

Sequence Type genomic DNA
Unitrap ID UNI13416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78791953..78792425 437
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]


Sequence tag IST10900E7HMR1
Sequence
NACACACCTGTGATCTCAGCCTTGGAAAGTGGATGCCGGAAGACCTGGTTTCAAATTTATTTAATTAAAATTTTTTTTTT
TTGGGTTTTGGGTTTTGGGTTTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78792435..78792536 96
 
EST/CDNA Est Name
  CA546734.1

 
Come back to gene CA546734.1


For any suggestions or comments, please send an email to unitrap@crg.es