Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14869D3
Clone ID IST14869D3
Vector VICTR76
Project tigm

Sequence tag IST14869D3BBF1
Sequence
GTTCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCN
Sequence Type genomic DNA
Unitrap ID UNI14376 UNI31048 UNI31049 UNI30731 UNI30898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15340639..15340705 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9850614..9850680 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3169818..3169884 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4887732..4887798 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 10205704..10205770 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16628977..16629043 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8697465..8697531 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15639283..15639349 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022672 (Prkdc) NM_011159 protein kinase, DNA activated, catalytic polypeptide Gene [Source:MGI Symbol;Acc:MGI:104779]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3761426..3761492 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5253636..5253702 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3509713..3509779 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5918681..5918747 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043241 (Upf2) NM_001081132 UPF2 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI (curated);Acc:Upf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9011537..9011603 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3873732..3873798 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3300620..3300686 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5023309..5023375 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032827 (Ppp1r9a) NM_181595 protein phosphatase 1, regulatory (inhibitor) subunit 9A Gene [Source:MGI Symbol;Acc:MGI:2442401]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3230720..3230786 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 8886055..8886121 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15169054..15169120 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161897: 42317..42383 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161898: 88388..88454 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042208..6042274 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 605480..605546 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069045 (Ddx3y) NM_012008 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]


Sequence tag IST14869D3HMR1
Sequence
NAACTCNNAANTCCGCCTGCCTCTGCCTCTGGAGTGCTGGGATTAAAGGCGTGCGCCACCGCCCAGTTTATCTATCTTTT
TAAACAAGACACTCAAAACACAGCGTTCCTCACAAGCTTTTGGCAGTACAATAAATAAAACTTCAAGAAATGTCTTTACT
TCGAATCACCTATTTGTCTCANAGAAAATGAAGTATCTACTTTGCTCGCATCGTGTTGAGAAGCCACAACCCAATTCCAC
AGAATCCCAAAACCTCACATCACTTAACAAAANNNNNNCNANTCTCCTTANTTTCTGAGAAACGGCCGCNNCNNNATAGG
TCNCTCCCTTTCNTANGCNAGCCCTTNACGTCCNANNNCNNNNTGGCTGCNCTNGGGGATTNCGGCNNTGGGTGGCNTGG
GGCACNTGNCNNCCNNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000069045


For any suggestions or comments, please send an email to unitrap@crg.es