Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P097E06
Clone ID P097E06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P097E06
Sequence
CGCGAGAAGGAGACGGACGTTGAGAGAACGAGGAGGAAGGCGAGAAAATGGCGTCCACGG
Sequence Type mRNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4999012..4999071 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


SPLK-Sequence tag 5SP097E06
Sequence
GATCCGGAGAGGAGACTCTTTTCCAGAAAGAGATTTCTAGCAGCTTTGATCCAGGAGAGGCAGAAAAGCCTCGGCACGCC
ACGTTTCTGTAGGCCTGCTCGTTAAGCTAGCCGGCTGATTTATTTCTTGGCCCTATTGAGGCCAGGGGAAGA
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998085..4998236 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


SPLK-Sequence tag 3SP097E06
Sequence
AAGAGCACCATAGCNNNNTTTGAAGTCCAGGGCGGGAACTCTAGAATGTGATGGTTATGTTGTGGTCCTTACCGAGAGAA
TAAGTGTAGCCTAGCCCTCACCTGCAGTTTAGAATACAGTTAACTGGCACAGTGGCGGGTTTTTTGTTTGTTTTTGTTTT
TGCTTCTAGCGGAATCTAGGGTCTGGTGATGTGGCCTTGGAGGCAGGAGGAGAAAACAAGTGGGGGTGACAGGAAAAGCT
CTGGGTTCTTCATTTGGCTTAGGAAAGCTTCCAGCATCACAATTTGACGACGCAAACGATGTAGTTAGTAAACAGCTTGC
TTTTGGCACCAGGCTACCCAGTGTCCCTAAGAGAAGACTGAGATACGACTACAGTCCAATATATCCTAGTGGAAAATGGT
TTCTTTGGTGGTCCTTTTACCCTTCTCTTAACCTCTAAAGCCCAAGAAGGCAATTGCAGCTTTTCTGCTTGATAGATCAT
TGCCACTTTTTAGTCATCTTTGTTATCAGAAAATGATGATAGCACCCTGAACCAAATTTAAGTTGAAAAGTGTGCTCTGC
TATACCCACAGTCCTGGCCCTGCTGAGGGGGACTTTATTAAGGGCTTTCCTGAAAAACTTAGTTTTAGACTTTTTTTAAA
GNNCCGGGGCGATGCA
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4997430..4998088 616
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es