Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14428F5
Clone ID IST14428F5
Vector VICTR74
Project tigm

Sequence tag IST14428F5HMR1
Sequence
CCNGCAGCCNCATGGTGGCTCACAACCNTCTGTAATGAGATTTGACGCCCTCTTCTGGTGTGTCTGAAGACAGCTACACT
GTACTCATACAAATAAAAATAAATTAATAAATCTTTAAAAAAAAAAANGGGAAAA
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121134546..121134679 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]


Sequence tag IST14428F5BBF1
Sequence
GAATTGANNTCAGGCCCTCTGGAAGAGCAGTCAGTGCTCTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14428F5HMF1
Sequence
GAATTGAACTCAGGCCCTCTGGAAGAGCAGTCAGTGCTCTTAACCGCTGANCCATCTCTCCAGTCCTCAGCTTTCATTTC
TTAAAATGAGAATTTTATTTAGTTTCACAGCAACTCTAATATTATCCTCAAAAACACCTACTACAGACCTTGAGATCCAT
CCCTGAATAAGATGCAGAATTTAATCTCTGACAGGAAGAAATAGACAATAACAAATTTTTTTTTGTGAGAAATTAACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121134308..121134545 236
NO GENE  

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es