Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14243A7
Clone ID IST14243A7
Vector VICTR74
Project tigm

Sequence tag IST14243A7HMR1
Sequence
GTCTTGACAGTAATAACCATAGCATATGTGGAAAAACCAACAAATAAACAACCTTTATTTGACAGATGTAGAAAATGAGA
AATTCTTTCCTTGTAAACTGATGTTCTTAGCACGTTATTAACCCAGTTAAGTGCTGGCAGTGAATAGTGATAGCTGCAGC
TATTTTTAAATACTGAGCGCCTAGTTTTCTCCATAACCATAAAGTTGCAAAAATATTGCTTTTCATTCCTGTGAAACAGA
AGAGTTAATGGCN
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34721334..34721585 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]

 
Come back to gene ENSMUSG00000028295


For any suggestions or comments, please send an email to unitrap@crg.es