Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14380A4
Clone ID IST14380A4
Vector VICTR74
Project tigm

Sequence tag IST14380A4HMR1
Sequence
NTTTCNNGNNNNNNNGNNNGTGNNCCNNANNAGTCAAAAAANANTGGTCGGACCATGCTCTCTGGTGGGAAAAGAAGAGG
ACTTGGCTGCTTAAGACACACTGGACCTTGGATAAGTGTGGCATCCAGGCAGATGCCAAGCTCCAGTTCACCCCGCAGCA
CAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGTGAACTTCTCTGACCGAGTCTTCAAGGCTG
TGTCTGACATCTGCAAGACTTTCAGTAAGTGACCTGCCCTTCGCTAANCCNNGAGGCGTGTGTGGCTGGTACTTGGCNNT
GAGCTNANTCTAANGGTGTCTGGGTTNGN
Sequence Type genomic DNA
Unitrap ID UNI21261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46124090..46124403 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]


Sequence tag IST14380A4HMF1
Sequence
AAAGGTTTAAAAATAGCCCAGAACACCTGGAGGGAAACTAAATACTGGGTACACTTAAGAAAAACAAGAAACTATTAGTG
ATAGGTACCAAAAAAAATACAAACAGTGCCAAAAAACACTTTCCCTGCCCTCAAAACCCANTGCACAGGAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46124433..46124591 157
NO GENE  

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es