Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15049G6
Clone ID IST15049G6
Vector VICTR80
Project tigm

Sequence tag IST15049G6HMR1
Sequence
NNATTNTANTTCTCTTCNGACACACCAGAAGAGGGCATCTCATCCCCTTACAAGTGGTTGTGAGCCACCACGTGGTTGCT
GGGAATTGAACTTAGGACCTTTGGAAGAGAACAGTCAGTTCTCTTAACCACTGAACCATCTCTCCAGCCCCAGCCTTTGT
TTTTAATTCATTAAATACTCAGCTATATATGTAGATGCCAATACCACAGAGAGGATCTGCTCCCACCCCAGCTGAGACAG
GTCATTCTTCTCTGAGCACACATTGTGTTTTGCCCCTCATCTCAGAAGTGTCCTTGTATCTCCTGCTGGCTTGATCTCTA
CAAGGAGGGGATCTTGACTTTCCAACCTATTGTTTGTCACAGAGTAGGGCTTGCTCAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI5735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38646706..38647085 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]


Sequence tag IST15049G6BBF1
Sequence
CAATGTACTCACATACATACGATAAATAAATAAATCTTTAAAACAAACAAACAAACAAACAAAACAAAGGCTGGCCTGGC
ATGGTTGTGTACACCTTTAATCCAAACATTCAGGAGGCAGAGGCAGGTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38647082..38647215 134
NO GENE  


Sequence tag IST15049G6HMF1
Sequence
CAATGTACTCACATACATACGATAAATAAATAAATCTTTAAAACAAACAAACAAACAAACAAAACAAAGGCTGGCCTGGC
ATGGTTGTGTACACCTTTAATCCAAACATTCAGGAGGCAGAGGCAGGTAGATCTCTAGAAGTTTGAGATCAGCCTGGTCT
TCAAAGCAAATCCAGGATAGTCAGGGCTGTTACACAGAGAAACCAGTCTCAAAAACAAGCAGGGCAATGGTGGATTTCTG
AGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGATATACAGAGAAACCCTGTCTCGAAAAACCAA
ACAACAACAACAACAACAAAACTAGATATCAAATAAAAGATATTGGGCTTCCATTGGTGACTTGAACACTACCTCCTCTG
TGCCNTCTCTCANANATAGACTCTTGGGANCAAACCTTCTTTTGGAACCNAANGTATTATCTATGCNATCCTTNANACAA
CNGCAGTNTGGNNNACANTGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38647082..38647583 472
NO GENE  

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es