Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14990F6
Clone ID IST14990F6
Vector VICTR78
Project tigm

Sequence tag IST14990F6HMR1
Sequence
TNGTTAGCACTGGTAATGTGTCTGAGAACCCAGCTCTCCACATTCAAACCTGACTGAGTTGCCTTTCTTGAGAACAGACA
ATAATGATGCCCTTTTCAGGAACCTGTTTCATGAAAACCTGGCTGACTTTAAAGAGAGGAGAGCAGAG
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33026774..33026919 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14990F6BBF1
Sequence
CTACAAGGAAACCACTTTTCCTTGTGCTAATTACAAGGAGCAGGGAGGAAACAGGCCAGGCCGAGAACAAATGCCTCAAA
AACAAAAAAGTGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAGAAGGAAAGAAAAGTCTACTTGCTTTTCAGAGGAGGG
ACTGGGCTTTGCAGAGAGCAGTCTGCCTCCCTGCCCAAATGCANCAACCCACTCTGCCCTAATTAATAGCATCTGGCNNC
GTTGTACAGTGATGATCTCANANCANCTTATAATCAATCCTTGGGCTCTCCTGGATCANAACNNNANCACANCGTTCTCC
TNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33026919..33027239 297
 
EST/CDNA Est Name
  BY320686.1

 
Come back to gene BY320686.1


For any suggestions or comments, please send an email to unitrap@crg.es