Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11137C8
Clone ID IST11137C8
Vector VICTR76
Project tigm

Sequence tag IST11137C8BBF1
Sequence
CTCCTGGCCGAAGAAGAAGGCCCAAAACAGGACCTTTCTCAGACAGTGTGTTGCTTTGGCAGTTCCCANGTGGTACAGAC
TCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAANATGGCGACCGCTGCTGCTGTGGCTTANGC
CGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACANGGNGCTGNCTC
ANCGCCTCTGTGCTTNTGCCTGTN
Sequence Type genomic DNA
Unitrap ID UNI31065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27620661..27620923 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64020736..64020998 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 51275458..51275720 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28188388..28188650 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14305940..14306202 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363442..22363704 247
 
EST/CDNA Est Name
  BY302409.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23740638..23740900 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82251753..82252015 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142391..25142653 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38492166..38492428 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28624288..28624550 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535603..18535865 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62715377..62715639 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16261402..16261664 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14606245..14606507 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 53524904..53525166 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 18769820..18770082 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 40217243..40217505 247
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31757533..31757795 247
NO GENE  

 
Come back to gene BY302409.1


For any suggestions or comments, please send an email to unitrap@crg.es