Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14867B6
Clone ID IST14867B6
Vector VICTR76
Project tigm

Sequence tag IST14867B6HMF1
Sequence
CTGGAAGAGAAGAGGGGCTAGGTGGCGAGAGAAAAGAATGTAGCCAAGACAGTTACTCTGATCAAGGCTCAAATTTTATT
GTTGCGACACTAGTTATGAAGGAAGGGGGAGGGGACCCGATTCCCGCCGAATAATCTCGGGTCCAGTAGAAAGGTGCACG
TGTGTGACTCCTCAGGTTCCANCNNTGGNNNTGGNANAN
Sequence Type genomic DNA
Unitrap ID UNI8820 UNI30626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77220700..77220887 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 134117057..134117244 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030199 (Etv6) NM_007961 ets variant gene 6 (TEL oncogene) Gene [Source:MGI (curated);Acc:Etv6-002]


Sequence tag IST14867B6BBF1
Sequence
CTGGAAGAGAAGAGGGGCTAGGTGGCGAGAGAAAAGAATGTAGCCAAGACAGTTACTCTGATCAAGGCTCAAATTTTATT
GTTGCGACACTAGTTATGAAGGAAGGGGGAGGGGACCCGATTCCCGCCGAATAATCTCGGGTCCNGTANAAAGGTGCACG
TGTGTGACTCCTCNGGTTCCANCANTGGGCNTGGCANANCNAATGANCANGANNCTCCNCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030199


For any suggestions or comments, please send an email to unitrap@crg.es